Move unsteadily from side to side.

Shake.

Tremble.

"Wobble" has been suggested as a name and pronounciation for the common prefix to URLs; "www." (including the following dot), to avoid the clumsy spelling that has been needed so far.

To exemplify; "www.google.com" should be pronounced "wobble google dot com".

As a side note, "hobble" is suggested as the correct way to pronounce "http://", so to say the aforementioned URL in a politically correct manner, say "hobble wobble google dot com".

Wobble is the relaxation of base-pairing rules in tRNA. This helps fill in the 16 amino acid codons that tRNA is missing (compaired to mRNA which has 61 amino acids, tRNA has 45).

Full description...
In order to understand wobble, one must first know this:

DNA his comprised of a double-helix. Each strand of DNA is made up of nitrogenous bases (either A for adenine, T for thymine, G for guanine, and C for cytosine). From one strand of the double-helix (the template strand), mRNA is transcribed, echoing the nitrogenous bases (besides replacing 'T' with 'U'). mRNA then travels out of the nucleous and into the cytosol, where it is at some point read by tRNA. tRNA is a funny fella. It connects to the mRNA with aid from ribosomes.

Time for an example:
This first are two fictional strands of DNA, wound into a double helix:

AGCAGTGCCTTCATGCATCGA
TCGTCACGGAAGTACGTAGCT

mRNA would pick one of those strands (the top one for example) to use as the template strand, and create this:

UCGUCACGGAAGUACGUAGCU

(notice that 'T' does not exist in mRNA, and is replaced by 'U')
End of example

Also, let it be known that mRNA is read in threes. This means that every three nitrogenous bases forms a new amino acid codon (UCG, UCA, and CGG happen to be the first amino acid codons in our facticious strand). tRNA has three nitrogenous bases that are in tRNA's 'anticodon' region, and thus echo an amino acid's structure in mRNA.

Again, time for example:
For example, our first amino acid, 'UCG' in mRNA, would be complemented by an anticodon from tRNA with the sequence of 'AGC', like so:

AGC
UCGUCACGGAAGUACGUAGCU

The first line is the tRNA anticodon, which affixes within a ribosome with the mRNA strand.
End of example

The wobble comes in when it was relized that a strand of tRNA only had about 45 amino acid codons, while there are 61 possible amino acid codons that mRNA can handle. Thus, scientists found that the nitrogenous bases tended to 'wobble' across the anticodon, thus actually allowing for more combinations of amino acid codons in the same tRNA.

The concept may seem scary or complex, but it really isn't. Go hit me up on the Chatterbox if you just don't get it :)

to wobble

To boil.

Pot wobbler ; one who boils a pot.

The 1811 Dictionary of the Vulgar Tongue.

Wob"ble (?), v. i.

See Wabble.

 

© Webster 1913.

Y'know, if you log in, you can write something here, or contact authors directly on the site. Create a New User if you don't already have an account.