A microsatallite is a stretch of
DNA, usually within a
nonsense region of a
genome, whose sequence is a pattern of one, two, three, or four
bases repeated over and over again, e.g.:
GGGGGGGGGGGGGGGGGGGGGGG
ATATATATATATATATATATAT
AGCAGCAGCAGCAGCAGCAGCAGC
GGTCGGTCGGTCGGTCGGTCGGTC
They can also be called SSR's (
simple sequence repeats), STR's (
short tandem repeats), or VNTR's (
variable number tandem repeats). Technically a microsatellite is 2-6 bases long, and a
minisatellite is 15-70 bases long, though the former term is used more frequently. Microsatellite regions have a high
mutation rate and an essentially random distribution throughout the
mitochondrial or
nuclear genome. They're currently used extensively as
genetic markers in the fields of
forensics,
molecular evolution, and
population studies.